Table of primers a Primer name Base position b Sequence 533 | Download Table
P. Azad et al. 1 SI Table S1 Primer sequences of genes tested by
View Image
Primer sequences used for Cyproquant assays Table shows position of... | Download Table
Table SI. Primer sequences for RT‑qPCR. Product Forward primer sequence Reverse primer sequence IL‑6 GAGGATACCACTCCCAACAGACC
Supplementary Table 3 PCR primer sequences for qPCR Gene symbol (human) Forward primer sequences (5'-3') Reverse primer sequence
JCI - E-cadherin expression on multiple myeloma cells activates tumor-promoting properties in plasmacytoid DCs
The primer sequences for qRT-PCR. | Download Table
Yamanaka, Mol Vis 2006; 12:841-851. Table 2.
PCR Primer Sequences | Download Table
View Image
RT-PCR PRIMER SEQUENCES. | Download Table
Khilko-2018. Nice paper. | by Eli Lyons | Medium
View Image
Primer sequence for qRT-PCR. | Download Table
Table S2. Primer Sequences
Table of RT-PCR primer sequences | Download Table
Supplementary Table 1: primer sequences - ppt download
Table 1 from Guelph Guelph , ON , Canada Single-Primer Amplification of Flanking Sequences | Semantic Scholar
Table of primer sequences. | Download Table
Scientific Protocols - SARS PCR/Sequencing Primers
View Image
PPT - Supplementary Table 2: Primers for constructing and sequencing pFex. PowerPoint Presentation - ID:4582870
![Table 1. Primer sequences, the expected product size for each used primer-set, and the appropriate annealing temperature used for PCR (Metabion) [4,5,6,13] : Mycobacterial Interspersed Repetitive Unit-variable Number Tandem Repeat (MIRU-VNTR) Typing](http://pubs.sciepub.com/ajmr/5/6/5/image/tab1.png "Table 1. Primer sequences, the expected product size for each used primer-set, and the appropriate annealing temperature used for PCR (Metabion) [4,5,6,13] : Mycobacterial Interspersed Repetitive Unit-variable Number Tandem Repeat (MIRU-VNTR) Typing")
Table 1. Primer sequences, the expected product size for each used primer-set, and the appropriate annealing temperature used for PCR (Metabion) [4,5,6,13] : Mycobacterial Interspersed Repetitive Unit-variable Number Tandem Repeat (MIRU-VNTR) Typing
Supplementary Table 2: Primer sequences and DHPLC conditions
Table S6. List of primers (Sequence 5' to 3') used in this study.
Tables_Page_1.jpg
